Molecular Genetic Research in Psychiatry

[Unknown]

"The Gene Illusion: Genetic Research in Psychiatry and Psychology Under the Microscope" - Jay Joseph, Psy.D.

CHAPTER 10. MOLECULAR GENETIC RESEARCH IN PSYCHIATRY

Schizophrenia

Researchers have been searching for “schizophrenia genes” for over 20 years. The most common methods in schizophrenia molecular genetic research are linkage and association studies. In a linkage study, researchers look for genetic markers linked with the putative disease gene among consanguineous family members. Findings are often represented as a logarithm of odds (LOD) score, which expresses the probability that the linkage occurred by chance. By convention, an LOD score higher than 3 (1000:1 odds in favor of linkage) is required in order to claim a significant linkage. Linkage studies are designed to identify areas of the chromosome where relevant genes might be located, but are unable to identify actual genes. This is the task of follow-up studies. Association studies compare the frequency of genetic markers among unrelated affected individuals and a control group.

Periodically, investigators claim to have found the location of genetic markers for schizophrenia. These studies usually are followed by retractions or failures to replicate. The most well-known example is Sherrington and colleagues’ 1988 study, which was accompanied by an article in the same issue of Nature by Kennedy et al., who failed to replicate the findings.1178 Another highly publicized yet subsequently withdrawn claim (this time for bipolar disorder) was published by Egeland and associates in 1987.1179 Unfortunately, it is widely believed in the general public that genetic markers for these and other conditions have been located, when it is not the case. Furthermore, finding a marker is not the same as finding an actual gene; it merely points to an area where the gene might be located. Still, when the public hears of studies purporting to find markers they often assume that a gene has been found. In an analogy discussed by psychologist Ty Colbert, finding a marker is similar to prospectors coming across traces of gold in a river.1180 This “marker” might indicate that a gold vein is nearby, or there could be other explanations. In any case, it would be premature to conclude that a gold vein had been discovered in the absence of other evidence. Colbert noted in this example that we at least can be sure that gold actually exists, which cannot be said about “mental illness” genes.

The numerous schizophrenia linkage studies, association studies, and genome scans have thus far failed to produce consistently replicated findings of any gene or marker. A large 2002 internationally-based schizophrenia linkage study of 382 sibling pairs by DeLisi and associates failed to replicate reports of linkage in several previous studies. The investigators acknowledged that the “most striking feature” of their results “is the failure to confirm a number of earlier claims of positive findings,” and wrote further that the “present findings suggest that a critical reevaluation of the linkage approach is warranted.”1181

Despite results of this type, the latter part of 2002 saw claims that susceptibility genes for schizophrenia had been discovered. For genetic researcher C. Robert Cloninger, the 2002 studies of Straub et al., Chumakov et al., and Stefansson et al. were a “watershed” event, and that for “the first time, specific genes have been discovered that influence susceptibility to schizophrenia . . .”1182 Cloninger’s claim, however, is more the result of wishful thinking than objective scientific evaluation. In addition to the premature nature of his conclusions, how can “schizophrenia susceptibility genes” (in reality, a mere association between “schizophrenia” and genetic markers) be found when, as a leading American biological psychiatrist and schizophrenia researcher has admitted, American psychiatry cannot even “figure out who really has schizophrenia or what schizophrenia really is.”1183 Nevertheless, genetic investigators Elkin, Kalidindi, and McGuffin echoed Cloninger in 2004 by proclaiming that “Schizophrenia genes have been found at last,”1184 although other leading researchers have been much more cautious.1185

Claims to the contrary notwithstanding, as of this writing molecular genetic studies have failed to find genes for schizophrenia. Most leaders of the field now believe that many genes are involved (the polygenic theory), and have abandoned the single-gene approach. Psychiatric geneticists Tsuang and Faraone wrote in 2000, “We can now conclusively reject the idea that there is one gene of major effect that causes schizophrenia.” They recommended that future researchers design studies “to detect the many genes of small effect that each increase susceptibility to the disorder.”1186 The title of the article in which these comments are found is, fittingly, “The Frustrating Search for Schizophrenia Genes.”

Tsuang and Faraone worried that “failures to replicate molecular genetic studies of schizophrenia might be interpreted to mean that schizophrenia genes do not exist,” and cautioned that such a conclusion would be “premature” because the results from twin and adoption studies show that genes play an important role.1187 While it is true that the failure to find schizophrenia genes does not prove that such genes do not exist, the belief that twin and adoption studies show that genes are involved is erroneous. The irony is that instead of confirming the results of schizophrenia twin and adoption research, the failure to find schizophrenia genes may lead researchers to take a much needed second look at this greatly flawed and environmentally confounded body of research. Schizophrenia genetic researcher Lynn DeLisi acknowledged in 2000 that “psychiatric genetics appears to be at a crossroads or crisis,” as investigators continue to look for the “elusive gene or genes” for schizophrenia.1188 She discussed “those researchers who entered the new [sic] field of psychiatric genetics [who] feared most of all that they would screen the whole genome and find nothing.”1189 This is precisely the “crisis” facing psychiatric genetics: Its adherents are looking for genes that may not even exist.

Another reason that investigators believe they will find genes is the concurrent (though not necessarily related) view of schizophrenia as a brain disease. Here again, as Peter Breggin has convincingly argued, the evidence is weak.1190 On the other hand, real brain diseases such as Alzheimer’s and Huntington’s disease are put forward by biological psychiatrists as examples of what can be accomplished for schizophrenia. For example, Nancy Andreasen referred to Alzheimer’s disease as “one of the current ‘stars’ in the molecular biology firmament.”1191 However, Alzheimer’s and Huntington’s are diseases of the brain, which can be seen in post-mortem examinations. These conditions, therefore, are not “behaviors” or “mental illnesses”; they are real brain diseases. Schizophrenia and most other psychiatric disorders, on the other hand, are affective states or socially disapproved behaviors given the name “disease” in the absence of convincing evidence in support of their biological bases. Why then do genetic researchers in psychiatry and psychology continue to point to Alzheimer’s and Huntington’s as examples of what they could find for conditions such as schizophrenia and attention-deficit hyperactivity disorder? The answer is that they have few other success stories to point to.

According to Thomas Szasz, when a psychiatric condition is shown to have a physical basis it leaves the domain of psychiatry and becomes a non-psychiatric medical concern: As soon as a disease thought to be mental is proven to be physical, it is removed from the domain of psychiatry and placed in that of medicine, to be treated henceforth by internists, neurologists, or neurosurgeons. This is what happened with paresis, pellagra, epilepsy, and brain tumors. It is an ironic paradox, then, that while definitive proof that mental illnesses are brain diseases would destroy psychiatry’s raison d’etre as a medical specialty distinct and separate from neurology, the claim that mental illness is a brain disease has served, and continues to serve, as the psychiatrist’s most effective justification for legitimacy as an independent medical discipline.1192

Thus, the psychiatric domain consists mainly of disorders that are claimed — but not proven — to have a biological basis. We might therefore say that psychiatry is where one will find pseudo brain diseases. The current multinational effort to find genes for schizophrenia is based on the position that it is a brain disease of genetic origin, yet there is little evidence in support of this view. The best course of action for molecular genetic investigators would be to perform their own critical reanalysis of the original twin and adoption studies, upon which their current search is based.

[Unknown]

WHY SEARCH FOR GENES?

Tsuang and Faraone listed three potential benefits of identifying genes for schizophrenia: “pharmacogenomics,” “pharmacogenetics,” and the identification of high risk children.1200 The first two words refer to producing psychotropic drugs with the aid of genetic information. Turning to the third potential benefit, despite the failure to find schizophrenia genes, some people have proposed the identification and “treatment” of so-called high risk children. But suppose, for the sake of argument, that schizophrenia really does have a genetic basis (which would then be triggered by environmental factors), and investigators are able to identify the predisposing gene or genes. The strategy of “early intervention” would still be problematic. The knowledge that a child is carrying schizophrenia genes could in itself be a life altering event, affecting the way he or she is treated by parents and the social environment. Even Andreasen admitted that “Treating young people who are not yet ill may adversely affect their self-esteem and selfimage, perhaps creating a self-fulfilling prophecy that may lead them to eventually become ill.”1201 If Tienari and colleagues are correct that the predisposition manifests itself in people who grow up in disturbed homes, would this mean that predisposed children would be removed from these types of homes? And who would decide what constitutes “disturbed?” Treatments proposed by psychiatric geneticists usually include neuroleptic (also known as “anti-psychotic”) drugs. These drugs, however, merely modify behavior or mood. They do not treat physical illness or “repair the brain.” Moreover, neuroleptics can cause troubling adverse effects and permanent neurological damage such as tardive dyskinesia. They can also be lethal (for example, they can cause neuroleptic malignant syndrome).1202 Furthermore, as seen in Mosher and colleagues’ Soteria project, non-medicated people diagnosed with schizophrenia who enter a supportive home-like treatment program show as much improvement as others hospitalized and prescribed neuroleptics.1203 Thus, even in the unlikely event that schizophrenia genes are found, society might still choose to focus on non-medical interventions, and on eliminating or mitigating schizophrenia-producing environments.

Early intervention would also be problematic in disorders such as ADHD. As Australian commentators Yeh and colleagues wrote, even if a child is found to carry ADHD susceptibility genes, it still would not mean that the child will necessarily develop ADHD. Moreover, they argued that for “polygenic disorders,” which they believe ADHD to be, “most individuals in the general population will carry one or more susceptibility alleles. Only a small percentage of individuals will carry enough susceptibility alleles to predict a high risk of developing the disorder.”1204 After citing potential stigmatization and other problems, they concluded “the importance of these issues should make us very cautious about accepting any proposals that may be made to test for ADHD susceptibility alleles in the general population.”1205

A potentially disturbing aspect of identifying genes for psychiatric disorders is that information could be used for eugenic purposes. The identification of genes would have been warmly embraced by people like Rüdin, Luxenburger, Kallmann and other racial hygienists and eugenicists in their quest to rid the world of the “schizophrenia phenotype.” As a contemporary German psychiatric genetic researcher observed, “doctors and scientists involved in the crimes of the Nazi period. . . . would undoubtedly have welcomed the technical possibilities of present-day genetics.”1206 According to genetic researchers Moldin and Gottesman, however, the discovery of genes would reduce stigma. They wrote that Sherrington and colleagues’ subsequently withdrawn 1988 finding was welcomed with considerable optimism and insufficient scientific criticism not only because hopes were raised of identifying a factor that could finally provide clues to pathophysiology and ultimately new treatments, but also because localization of a locus was “confirmation” that schizophrenia was in fact “biological” and not a “psychosocial” disorder. The long history of stigma associated with schizophrenia further reinforces the desire to see schizophrenia as a genetic or medical condition.1207

However, the “long history” of the stigmatization of people diagnosed with schizophrenia is directly related to their being viewed as the carriers of “hereditary taint.” Even behavior geneticists Plomin and Rutter acknowledged that the 20th century provided “chilling examples of compulsory sterilization an the name of eugenics and of genetic stigmatization.”1208 Although it is true that psychosocial theories can also stigmatize families (or parents), there is a huge difference between the stigma of being a “bad parent,” and the stigma of being seen as a carrier of “bad genes.” While psychoanalysts may have stigmatized “schizophrenogenic” parents from time to time, the stigma of being a “hereditary taint carrier” has led to the perpetration of crimes against people diagnosed with schizophrenia and other psychiatric or mental conditions. Thus, there is little to be gained by finding presumed schizophrenia genes, but the potential for misuse of this information is enormous.

[Unknown]

CONCLUSIONS

The failure to find genes for schizophrenia, ADHD, and other conditions, while not proving that these genes do not exist, is a testimony to the blind faith in the claims made by twin and adoption researchers. Rather than consider the possibility that genes do not exist, investigators such as Tsuang and colleagues discuss the “great strides” in finding genes, and that recent technology has led to the “implication of genes at several chromosomal loci.”1233 Others claim that they are “closing in on genes for manic-depressive illness and schizophrenia.”1234 More recently, Plomin wrote that according to geneticists, “we will be awash with genes associated with complex traits including behaviour in the next few years,” 1235 and that the “future for genetic research in intelligence and other areas of personality looks brighter than ever in the dawn of the post-genomic era.”1236 And in a 2001 testimony to the fact that no histopathology has been shown to cause schizophrenia, Andreasen spoke of the condition being caused by an “‘invisible lesion’ that cannot be seen with the naked eye or under a microscope.”1237 (Perhaps the next step is to assert that schizophrenia is inherited through “invisible genes”?) All of this is said to avoid having to admit that they have found nothing important, and might not find anything important in the future. As Szasz once observed, “Much of what passes for scientific advance in psychiatry is, in fact, rhetorical innovation.” Generally speaking, molecular genetic investigators use “rhetorical innovation” in their publications in order to obscure the failure to find genes in their laboratories. Ultimately, however, the use of language cannot eliminate the necessity of finding actual genes.

In the psychiatric genetic and molecular genetic literature it is striking how little attention is paid to people’s social environment as having anything to do with the causes of “mental illness.” The causes are viewed as residing at the molecular level. Andreasen has argued that it is important to understand how “proteins are created through our DNA . . . since it will ultimately explain how mental illnesses are caused, treated, and prevented.”1238 This statement epitomizes the reductionistic view of human problems. In the past, such views were sustained because, in addition to their usefulness in absolving social conditions and political policies from causing human distress, the technology was not available to put reductionism to the test. Now that the technology is available, molecular geneticists in psychiatry may suffer through the failure to find genes for the dubious “diseases” they are investigating. The title of a 1992 article by psychiatric geneticist Michael Owen asked, “Will schizophrenia become a graveyard for molecular geneticists?”1239 The answer, at least as it relates to psychiatric disorders, may well turn out to be yes.

Reductionistic views can also be found among those looking for genes for “continuously distributed” traits such as personality and IQ. Although lip service is given to the environment, behavioral and performance differences are viewed as ultimately residing in the genes. Here again, the evidence suggests that nothing important will be found. Like the psychiatric geneticists, behavior geneticists have painted themselves into a corner, although as we have seen, some are already planning their escape. And escape they will, since the mistaken view that “genes are destiny” is needed by powerful and well-connected interests promoting political, professional, and business agendas.

In short, behavior genetics and psychiatric genetics may well have their Waterloo in molecular genetic research, even though this may not become apparent for quite some time. If it does, it will motivate investigators to reexamine the unsound research that inspired their search for genes in the first place.

[Agata M]

.

[Agata M]

.

[Unknown]

TERAZ SIE wycofuja ,ze to musi byc grupa genow, a pewnie wystarczy jeden gen(mowia,ze juz go maja) i bedzie znaczna poprawa leczenia np:leczenie co rok albo poł,ale to sie pewnie nie opłaca.

Nie wycofują się, idą do przodu w swoich wieloletnich i dobrze opłacanych poszukiwaniach 'niewidzialnych' genów wszystkich chorób psychicznych, czyli nowej hipotezy jaką stworzą w celu zwiększenia sprzedaży psychotropów. Kiedy "odkryją" już ten marker podobnie jak "zaburzoną dopaminę" - inną biochemię w mózgach schizofreników powodowaną leczeniem neuroleptykami, będą mogli zmuszać także ich rodziny do zażywania leków profilaktycznie - może część z nich sama się wtedy na to zgodzi z obawy przed nieuniknioną psychozą... Chyba nikt z was nie liczy na lepsze, nieszkodliwe leki? Jakie korzyści miałyby firmy farmaceutyczne z utraty pacjentów?

[Niemamnie]

Sekwencja genu mir-137, odpowiada za regulację ekspresji genów.
>mmu-miR-137-5p MIMAT0016986
ACGGGUAUUCUUGGGUGGAUAAU

Gene: CACNA1C ENSFALG00000003063
GTTAAACTTTCAGATCGAGTCCGGCGGCTCCCAGCGCCGTGCGCGGGGAGCTGCGTGCGG
CCGCCGCAGCTGGAACATCTGGAAGCGTTCAGTGTGTCTGTCTGTCGGCGAGAGGGAGAG
AGCGGAGAGCGAGCGCGCTGAGGGAGGGGAGGGAGTAAGGGGCTGGGACTTGCTCTCTTC
CTCTGCAGAAACAGCTCCCTGCCAACACAACGCGCTCAGAATGGCTTTGAAGAGGAGGAG
CAGCAGCGTTTGAACATCTCCCTTTTTTTTTTTGTTCCTCTTCCTCCTGTTGTTACTCTT
GTAGTTGGTGGATTTTAAAAAGACATTTAACCCTCAGAGGTTTGTCCTGGATGCTTTTGC
TTTTTTCCTTCCCCCCCGCCCCCCTCTCGTTTCCCCCCTTCCTGTTCTTTTTTATGGTTT
AACAGCCAGAGGTGCTGTGCTAAATTCTTGGAAGGGGCCCGGATGTACTGAGGATGCATT
GCAATTTCACTAAAGGAGGCAGTAGTGGAAAGGATCAGTTTTTGGTGTTTGATGCAATAA
TGGGAATCAGGTAATAATAAAAGGGGAAATTCTGCAGCTCCATTCTTCCTTGAATTTTAC
CAAGCCGATTTTCGGAGGGATTATCCTGGACTCGTTTTAAATGGTCAATGAAAACAAGAG
GATGTACATTCCAGAAGAAAACCATCAAG

Gene: Cacnb2 ENSDORG00000001954
TCTTATGGAAAAGGAGCCAGAAGGAAGAACAGATTTAAAGGATCTGACGGAAGTACCTCC
TCTGATACTACCTCAAATAGTTTCGTTCGTCAG

Na mir-137 raczej nie będzie leków.

http://bioinfo.mc.vanderbilt.edu/SZGR/index.jsp
Postępy w analizie genomu pod względem schizofrenii można śledzić na tej stronie.
Jak widzicie naukowcy nie przeszukują genomu tylko w poszukiwaniu genów odpowiedzialnych za syntezę dopaminy, więc mądrzy ludzie zajmują się tym co należy.

[Unknown]

Protein flexibility plays a major role in biomolecular
recognition. In many cases, it is not obvious how
molecular structure will change upon association with
other molecules. In proteins, these changes can be
major, with large deviations in overall backbone struc-
ture, or they can be more subtle as in a side-chain
rotation. Either way the algorithms that predict the
favorability of biomolecular association require rela-
tively accurate predictions of the bound structure to
give an accurate assessment of the energy involved in
association. Here, we review a number of techniques
that have been proposed to accommodate receptor
flexibility in the simulation of small molecules binding
to protein receptors. We investigate modifications to
standard rigid receptor docking algorithms and also
explore enhanced sampling techniques, and the com-
bination of free energy calculations and enhanced
sampling techniques. The understanding and allow-
ance for receptor flexibility are helping to make com-
puter simulations of ligand protein binding more
accurate. These developments may help improve the
efficiency of drug discovery and development. Effi-
ciency will be essential as we begin to see personal-
ized medicine tailored to individual patients, which
means specific drugs are needed for each patient’s
genetic makeup.
...
Concluding Remarks
There has been tremendous progress in the field of per-
sonalized sequencing of genetic code within the past
20 years. The ’$100 genome’ is within reach in our gener-
ation. The possibility of personalized genetic knowledge of
specific diseases has unprecedented potential for targeted
drug treatment. This exciting development goes hand in
hand with advances in computer-aided drug design that
can be used to discover novel leads targeting specific
mutant receptors. Here, we presented recent develop-
ments in computational algorithms and hardware used in
drug discovery with a focus on using enhanced protein
dynamics sampling techniques to aid in the incorporation
of full receptor flexibility in structure-based drug discovery.
In the near future, it should be possible to include the
effects of genetic variation in models of drug targets and
speed the choice of therapies appropriate for individual
patients. The effects of genetic variation not only lead to
sequence changes, but structural and dynamical changes
too. Thus, we anticipate that computer-aided drug discov-
ery, which accommodates receptor flexibility, will be an
important component of pharmacogenomics in the near
future opening many new and exciting opportunities for
combining the two techniques.

- http://cbb.sjtu.edu.cn/~qinxu/files/pap ... DD2013.pdf

[Niemamnie]

Na mir-137 raczej nie będzie leków.

Pozwól że rozwinę. Mir-137 nie koduje białka, tylko odcinek RNA który jest potrzebny przy projektowaniu wielu białek,
cała aparatura białkowa jest przez to zachwiana a przy czymś tak wrażliwym jak komórka nerwowa nawet niewielkie zmiany mają ogromne znaczenie.

[F20]

Tutaj jest chyba na razie tylko naukowe laboratorium do tych celów: http://www.microarrays.pl/?page_id=3